Recent News
  • 05-11-2010: since several days, you may experience temporary network problems by using Assemble, S2S or the RNA WebServices. The network of the University of Strasbourg is migrating to a new architecture. We apologize for the inconvenience.
  • 04-21-2010: the new Web Service Infer3D is now available.
  • 02-12-2010: the Web Service Annotate3D has been updated. Using the "pdbid" option, it can download data directly from the Protein Data Bank. To do so, the "data" option of the Java client has to be equal to "-". The Java client has been updated, you can download it here.
How to use the RNA Web Services?
We're providing RNA algorithms as Web Services. These Web Services can be used:
  • transparently with our graphical tools Assemble and S2S
  • by using any tool able to retrieve data from a Web address (Web browsers (Internet Explorer, FireFox, Google Chrome,...), wget, curl,....). Our Web Services can be reached with Web addresses conforming to the following pattern:
    http://paradise-ibmc.u-strasbg.fr/webservices/webservice_name?option1=value1&option2=value2&....
  • by using one of our dedicated tools (see below for details)
Constructing the web address by yourself can be difficult if the option values to send are large. Consequently, we're providing dedicated tools to reduce this difficulty.
Our dedicated Tools
Our Java Tool
To use our java tool, you need to have at least Java 1.4 installed on your computer. Then:
  • download and install the java client
  • unzip the client.zip file in a directory of your choice. This will produce two files: client.jar and commons-io-1.4.jar
  • in this directory, the client is used by typing in a terminal the following command:
    java -jar client.jar ws=webservice_name option1=value1 option2=value2 ....
    The java client uses the informations precised on the command line to construct automatically your request. Its result is displayed in your terminal.
Our Ruby Tool
To come....
Our Python Tool
To come....
The RNA Web Services available
  • AlignSequences: compute alignment between RNA sequences
  • Annotate3D: compute a Secondary Structure from a tertiary one
  • Convert: compute conversions between several file formats
  • Infer3D: thread a new sequence into a RNA 3D structure
  • Plot2D: compute a 2D sketch for an RNA Secondary Structure
  • Predict2D: compute a Secondary Structure for an RNA sequence
  • Predict3D: compute a Tertiary Structure from a secondary one
General informations about the file formats used
In this section, we reproduce several examples of the file formats used by our Web Service as inputs and ouputs:
  • FASTA: 
    >my rna
TAACAATCTGCTGAAAGGTACCGTCGGAGGGAGCTTTGTTGCCAGCGCCA
GAAACGCCGGTTTAACCAGCGCCGAAGTGAGCGCAGTGATTAAAGCCATG
CAGTGGCAAATGGATTTCCGCAAACTGAAAAAAGGCGATGAATTTGCGGT
  • CT:
    • 50 ENERGY =    -8.5    my_rna
1 G       0    2    0    1
2 A       1    3    0    2
3 G       2    4    0    3
4 A       3    5    0    4
....
47 U      46   48   18   47
48 G      47   49   17   48
49 G      48   50   16   49
50 U      49    0   15   50
  • BPSEQ:
    • 1 U 0
2 A 0
3 A 0
4 C 0
...
146 G 121
147 C 120
148 G 119
149 G 118
150 U 0
  • VIENNA: 
    >my rna
UAACAAUCUGCUGAAAGGUACCGUCGGAGGGAGCUUUGUUGCCAGCGCCA
.........((((.(((((.((......))..))))).....))))....
  • PDB: a complete description can be found here
  • RNAML: a complete description can be found here
Contacts
This project is managed by Dr. Fabrice Jossinet. It is developed in the laboratory of Pr. Eric Westhof at the "Institut de Biologie Moleculaire et Cellulaire" of Strasbourg, France (Team "Architecture et Réactivité de l'ARN", UPR 9002 of CNRS, Université de Strasbourg).
For any questions or remarks, please contact f[dot]jossinet[at]ibmc[dot]u-strasbg[dot]fr (if you're not a robot, you will know what to do with this email!!)